Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-30d-5p URS000005CF5F_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-30d: Rno-mir-30d is a microRNA that has been found to target differentially expressed mRNAs [PMC5485288]. In a study, fish oil feeding was shown to reduce the expression of rno-miR-29c and increase the expression of rno-miR-328 and rno-mir-30d, which in turn regulated the expression of Per3, Pcsk9, and Socs1 [PMC5485288]. The expression of rno-miR-29c, rno-miR-328, and rno-mir-30d was further examined using qRT-PCR to validate the findings [PMC5485288]. The miR-30 family includes several miRNAs such as rno-mir-30d that are mainly enriched in the oxidation-reduction process [PMC8315965]. Fish oil supplementation has been shown to alter hepatic expressions of miRNAs including rno-mir-30d, which may contribute to its amelioration of non-alcoholic fatty liver disease (NAFLD) in rats [PMC6321427]. Rno-mir-30b and rno-mir-30d have been found to have a large number of targets [PMC2990713]. These microRNA genes are located within a set of CNV regions associated with type 2 diabetes (T2D) susceptibility loci involving protein-coding genes as well as microRNA genes [PMC2990713][PMC4631338]. Rno-mir-30d is one of the most abundant microRNAs with 50 known validated targets [PMC4113183].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCCCGACUGGAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Anolis carolinensis (green anole) aca-miR-30d-5p
  2. Capra hircus (goat) miR-30d
  3. Danio rerio (zebrafish) dre-miR-30d
  4. Equus caballus (horse) eca-miR-30d
  5. Gallus gallus gga-miR-30d
  6. Gorilla gorilla gorilla ggo-miR-30d (MIR30D)
  7. Gorilla gorilla ggo-miR-30d
  8. Homo sapiens hsa-miR-30d-5p
  9. Macaca mulatta (Rhesus monkey) mml-miR-30d-5p
  10. Macaca nemestrina (pig-tailed macaque) mne-miR-30d
  11. Monodelphis domestica mdo-miR-30e-5p
  12. Mus musculus mmu-miR-30d-5p
  13. Ovis aries (sheep) miscellaneous RNA
  14. Pan paniscus (pygmy chimpanzee) ppa-miR-30d
  15. Pan troglodytes (chimpanzee) ptr-miR-30d
  16. Pongo pygmaeus (Bornean orangutan) ppy-miR-30d
  17. Takifugu rubripes fru-miR-30d
  18. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-30d
  19. Tor tambroides (Thai mahseer) miR-30b
  20. Xenopus tropicalis (tropical clawed frog) xtr-miR-30d
Publications