Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Arg (anticodon CCT) 3-1 secondary structure diagram

Homo sapiens (human) tRNA-Arg (anticodon CCT) 3-1 URS000005A7A9_9606

Automated summary: This tRNA sequence is 73 nucleotides long and is found in Homo sapiens. Annotated by 5 databases (ENA, Rfam, GeneCards, GtRNAdb, HGNC). Described in 7 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Homo sapiens (human) tRNA-Arg (anticodon CCT) 3-1 sequence is a product of tRNA-Arg-CCT-3-1, TRR-CCT3-1 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCCCCGGUGGCCUAAUGGAUAAGGCAUUGGCCUCCUAAGCCAGGGAUUGUGGGUUCGAGUCCCACCCGGGGUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 65 other species

    1. Ailuropoda melanoleuca tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    2. Balaenoptera acutorostrata scammoni tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    3. Bos taurus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
    4. Callithrix jacchus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    5. Camelus ferus tRNA
    6. Canis lupus familiaris tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    7. Carlito syrichta tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
    8. Cavia porcellus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    9. Ceratotherium simum simum tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    10. Chlorocebus sabaeus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    11. Cricetulus griseus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
    12. Dasypus novemcinctus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
    13. Echinops telfairi tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
    14. Equus caballus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    15. Erinaceus europaeus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    16. Felis catus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    17. Gorilla gorilla gorilla tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    18. Ictidomys tridecemlineatus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
    19. Macaca mulatta tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    20. Marmota monax tRNA.Arg
    21. Mesocricetus auratus tRNA
    22. Microcebus murinus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    23. Mus caroli tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    24. Mus musculus castaneus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    25. Mus musculus domesticus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    26. Mus musculus musculus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    27. Mus musculus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    28. Mus pahari tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    29. Mus spretus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    30. Mustela putorius furo tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    31. Neotoma lepida tRNA
    32. Nomascus leucogenys tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    33. Oryctolagus cuniculus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    34. Ovis aries tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    35. Pan troglodytes tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1, tRNA-Arg-CCT-4-2)
    36. Papio anubis tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    37. Pongo abelii tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    38. Procavia capensis tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    39. Pteropus alecto tRNA
    40. Rattus norvegicus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    41. Saimiri boliviensis boliviensis tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    42. Sorex araneus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
    43. Sus scrofa tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
    44. Tursiops truncatus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    45. Vicugna pacos tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
    2D structure New