Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Ailuropoda melanoleuca tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1) secondary structure diagram

Ailuropoda melanoleuca tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1) URS000005A7A9_9646

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCCGGUGGCCUAAUGGAUAAGGCAUUGGCCUCCUAAGCCAGGGAUUGUGGGUUCGAGUCCCACCCGGGGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Balaenoptera acutorostrata scammoni tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  2. Bos taurus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  3. Callithrix jacchus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  4. Camelus ferus tRNA
  5. Canis lupus familiaris tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  6. Carlito syrichta tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  7. Cavia porcellus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  8. Ceratotherium simum simum tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  9. Chlorocebus sabaeus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  10. Cricetulus griseus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  11. Dasypus novemcinctus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  12. Echinops telfairi tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  13. Equus caballus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  14. Erinaceus europaeus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  15. Felis catus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  16. Gorilla gorilla gorilla tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  17. Homo sapiens tRNA-Arg (anticodon CCT) 3-1 (TRR-CCT3-1)
  18. Ictidomys tridecemlineatus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  19. Macaca mulatta tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  20. Marmota monax tRNA.Arg
  21. Mesocricetus auratus (golden hamster) tRNA
  22. Microcebus murinus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  23. Mus caroli tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  24. Mus musculus castaneus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  25. Mus musculus domesticus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  26. Mus musculus musculus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  27. Mus musculus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  28. Mus pahari tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  29. Mus spretus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  30. Mustela putorius furo tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  31. Neotoma lepida (desert woodrat) tRNA
  32. Nomascus leucogenys tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  33. Oryctolagus cuniculus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  34. Ovis aries tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  35. Pan troglodytes tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1, tRNA-Arg-CCT-4-2)
  36. Papio anubis tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  37. Pongo abelii tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  38. Procavia capensis tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  39. Pteropus alecto tRNA
  40. Rattus norvegicus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  41. Saimiri boliviensis boliviensis tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  42. Sorex araneus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  43. Sus scrofa tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  44. Tursiops truncatus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  45. Vicugna pacos tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
2D structure Publications