Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4775 URS000005542C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4775: Hsa-mir-4775 is a microRNA that has been found to be upregulated in patients with Alport syndrome, suggesting its involvement in the disease [PMC7998154]. It has also been identified in several other studies [PMC9742375]. Hsa-mir-4775 has been shown to target the ATF2 gene, which is involved in arresting viral infection, as well as SMAD7, a protein involved in the TGF-beta signaling pathway [PMC9742375]. It has been found to be the most prominent miRNA in terms of associations with proteins and target transcripts [PMC6297794]. Hsa-mir-4775 has also been implicated in colorectal cancer invasion and metastasis [PMC6297794]. Additionally, it has been predicted to target the 3╩╣UTR of SARS-CoV-2 and play a role in modulating the immune response after infection [PMC8201247]. In relation to diabetic nephropathy, hsa-mir-4775 is associated with targeting apoptotic pathway core genes and upregulating CFB gene expression [PMC8527307]. Furthermore, hsa-mir-4775 has been shown to bind to DCP1B mRNA and its binding may be affected by genetic variations [PMC4093940]. Overall, hsa-mir-4775 appears to play a role in various diseases and biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAAUUUUUUGUUUCGGUCACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications