Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-324 URS000005481D_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGCAUCCCCUAGGGCAUUGGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus bta-miR-324
  2. Callithrix jacchus cja-miR-324
  3. Capra hircus (goat) chi-miR-324-5p
  4. Cavia porcellus cpo-miR-324-5p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-324-5p
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-324_5p (mature (guide))
  7. Equus caballus (horse) eca-miR-324-5p
  8. Homo sapiens (human) Hsa-Mir-324_5p (mature (guide))
  9. Macaca mulatta (Rhesus monkey) mml-miR-324-5p
  10. Mus musculus mmu-miR-324-5p
  11. Nomascus leucogenys nle-miR-324
  12. Oryctolagus cuniculus ocu-miR-324-5p
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-324-5p
  14. Rattus norvegicus rno-miR-324-5p
  15. Sus scrofa (pig) ssc-miR-324
  16. Tupaia chinensis (Chinese tree shrew) tch-miR-324-5p
Publications