Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cavia porcellus (domestic guinea pig) cpo-miR-324-5p URS000005481D_10141

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGCAUCCCCUAGGGCAUUGGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus (cattle) bta-miR-324
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-324
  3. Canis lupus familiaris (dog) cfa-miR-324
  4. Capra hircus chi-miR-324-5p
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-324-5p
  6. Echinops telfairi Ete-Mir-324_5p (mature (guide))
  7. Equus caballus eca-miR-324-5p
  8. Homo sapiens (human) Hsa-Mir-324_5p (mature (guide))
  9. Macaca mulatta mml-miR-324-5p
  10. Mus musculus mmu-miR-324-5p
  11. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-324
  12. Oryctolagus cuniculus ocu-miR-324-5p
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-324-5p
  14. Rattus norvegicus (Norway rat) rno-miR-324-5p
  15. Sus scrofa ssc-miR-324
  16. Tupaia chinensis tch-miR-324-5p