Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-324_5p (mature (guide)) URS000005481D_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 6 databases (LncBase, MalaCards, TarBase, GeneCards, MirGeneDB, ENA). Described in 18 papers. Homo sapiens (human) Hsa-Mir-324_5p (mature (guide)) sequence is a product of miR-324-5p, hsa-miR-324, hsa-miR-324-5p, MIR324, miR-324 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 182-FIP, 239FB, 30K, 7h3, 82-FIP, ABBA, ABBA-1, ABP1, ACBD1.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CGCAUCCCCUAGGGCAUUGGUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Bos taurus (cattle) bta-miR-324
    2. Callithrix jacchus cja-miR-324
    3. Canis lupus familiaris cfa-miR-324
    4. Capra hircus chi-miR-324-5p
    5. Cavia porcellus (domestic guinea pig) cpo-miR-324-5p
    6. Dasypus novemcinctus dno-miR-324-5p
    7. Echinops telfairi Ete-Mir-324_5p (mature (guide))
    8. Equus caballus (horse) eca-miR-324-5p
    9. Macaca mulatta mml-miR-324-5p
    10. Mus musculus (house mouse) mmu-miR-324-5p
    11. Nomascus leucogenys nle-miR-324
    12. Oryctolagus cuniculus (rabbit) ocu-miR-324-5p
    13. Pongo pygmaeus (Bornean orangutan) ppy-miR-324-5p
    14. Rattus norvegicus (Norway rat) rno-miR-324-5p
    15. Sus scrofa ssc-miR-324
    16. Tupaia chinensis tch-miR-324-5p