Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) Hsa-Mir-324_5p (mature (guide)) URS000005481D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-324: Hsa-mir-324 is a microRNA that has been found to be associated with progression pathways in triple-negative breast cancer (TNBC) [PMC4633580]. A study identified three miRNAs, including hsa-mir-324, to be linked to TNBC progression pathways, but did not integrate these miRNAs with TNBC genes alone or compare them to normal tissue or lymph node metastases [PMC4633580]. Another study found that 4-AAQB, a compound, enhanced the anticancer effect of FOLFOX (folinate, fluorouracil, and oxaliplatin) by re-expressing hsa-mir-324 that was inhibited by SOD2 and suppressing SOD2-mediated tumorigenicity [PMC9164036]. Hsa-mir-324 is a type of microRNA that has been implicated in the progression of triple-negative breast cancer (TNBC) [PMC4633580]. A study identified three miRNAs associated with TNBC progression pathways, including hsa-mir-324 [PMC4633580]. However, this study did not integrate these miRNAs with TNBC genes alone or compare them to normal tissue or lymph node metastases [PMC4633580]. Another study found that 4-AAQB enhanced the anticancer effect of FOLFOX by re-expressing hsa-mir-324 inhibited by SOD2 and suppressing SOD2-mediated tumorigenicity [PMC9164036].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGCAUCCCCUAGGGCAUUGGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus (cattle) bta-miR-324
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-324
  3. Canis lupus familiaris (dog) cfa-miR-324
  4. Capra hircus chi-miR-324-5p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-324-5p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-324-5p
  7. Echinops telfairi Ete-Mir-324_5p (mature (guide))
  8. Equus caballus eca-miR-324-5p
  9. Macaca mulatta mml-miR-324-5p
  10. Mus musculus mmu-miR-324-5p
  11. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-324
  12. Oryctolagus cuniculus ocu-miR-324-5p
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-324-5p
  14. Rattus norvegicus (Norway rat) rno-miR-324-5p
  15. Sus scrofa ssc-miR-324
  16. Tupaia chinensis tch-miR-324-5p
Publications