Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Brassica napus (rape) bna-miR403 URS0000047B71_3708

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAGAUUCACGCACAAACUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Arabidopsis lyrata (lyrate rockcress) aly-miR403a-3p
  2. Arabidopsis thaliana ath-miR403-3p
  3. Brassica rapa bra-miR403-3p
  4. Citrus sinensis (sweet orange) csi-miR403b-3p
  5. Corchorus capsularis sRNA CCACVL1_22106
  6. Corchorus olitorius aly-miR403-
  7. Cynara cardunculus var. scolymus cca-miR403
  8. Helianthus annuus ath-miR403-3p
  9. Helianthus argophyllus har-miR403a
  10. Helianthus petiolaris hpe-miR403a
  11. Helianthus tuberosus (Jerusalem artichoke) htu-miR403a
  12. Malus domestica mdm-miR403a
  13. Manihot esculenta (cassava) mes-miR403a
  14. Nicotiana attenuata microRNA mir-403-like
  15. Populus tomentosa Pto-miR403b
  16. Populus trichocarpa ptc-miR403d
  17. Prunus persica ppe-miR403
  18. Ricinus communis rco-miR403b
  19. Theobroma cacao tcc-miR403a
  20. Vitis vinifera (wine grape) vvi-miR403a
Publications