v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-378 URS00000451A1_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-378: As shown in Figure 3 [PMC3528764], the expression of ssc-mir-378 was extremely low in 33 dpc, increased in 65 and 90 dpc, reached its maximum level at postnatal day 0, decreased during postnatal individual growth and was maintained at a stable level in the adult stage [PMC3528764]. Ssc-miR-206, ssc-miR-1 and ssc-mir-378 had the most reads in our Solexa results [PMC3528764].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUGGACUUGGAGUCAGAAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Bos taurus (cattle) bta-miR-378
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-378
  3. Canis lupus familiaris (dog) cfa-miR-378
  4. Capra hircus chi-miR-378-3p
  5. Cavia porcellus cpo-miR-378-3p
  6. Cervus elaphus cel-miR-378
  7. Cricetulus griseus cgr-miR-378-3p
  8. Dasypus novemcinctus dno-miR-378-3p
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-378_3p (mature (guide))
  10. Homo sapiens hsa-miR-378a-3p
  11. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-378
  12. Macaca mulatta (Rhesus monkey) Mml-Mir-378_3p (mature (guide))
  13. Mus musculus Mmu-Mir-378_3p (mature (guide))
  14. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-378a
  15. Oryctolagus cuniculus (rabbit) ocu-miR-378-3p
  16. Otolemur garnettii (small-eared galago) oga-miR-378
  17. Pan paniscus (pygmy chimpanzee) ppa-miR-378a
  18. Papio hamadryas (hamadryas baboon) pha-miR-378
  19. Pteropus alecto (black flying fox) pal-miR-378-3p
  20. Rattus norvegicus (Norway rat) Rno-Mir-378_3p (mature (guide))
  21. Tupaia chinensis tch-miR-378a-3p
 Publications