Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-378 URS00000451A1_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-378: As shown in Figure 3 [PMC3528764], the expression of ssc-mir-378 was extremely low in 33 dpc, increased in 65 and 90 dpc, reached its maximum level at postnatal day 0, decreased during postnatal individual growth and was maintained at a stable level in the adult stage [PMC3528764]. Ssc-miR-206, ssc-miR-1 and ssc-mir-378 had the most reads in our Solexa results [PMC3528764].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGACUUGGAGUCAGAAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

Publications