Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-378 URS00000451A1_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-378: Bta-mir-378, a microRNA, was found to be a target of novel_circ_0000628 in a study [PMC7230347]. In the same study, bta-miR-200a was also identified as a target of novel_circ_0000628 [PMC7230347]. Several microRNAs, including bta-miR-181a, bta-miR-20a, bta-miR-30b-5p, and bta-mir-378, were selected as endogenous controls for qRT-PCR assays due to their high expression levels and lack of significant differences between treatments [PMC6691986]. These microRNAs were employed as reference controls in the study to ensure accurate quantification of gene expression levels [PMC6691986]. The use of endogenous controls is crucial in qRT-PCR assays as they provide a stable reference for normalization and help account for technical variations [PMC6691986]. The selection of appropriate endogenous controls is essential to ensure reliable and accurate gene expression analysis [PMC6691986]. In this study, bta-mir-378 was one of the microRNAs chosen as an endogenous control due to its stable expression across treatments [PMC6691986]. The use of multiple endogenous controls further enhances the reliability and robustness of qRT-PCR assays by minimizing potential biases or variations in gene expression analysis [PMC6691986].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGACUUGGAGUCAGAAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

Publications