Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-378 URS00000451A1_9615

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Canis lupus familiaris. Annotated by 3 databases (RefSeq, MirGeneDB, miRBase). Described in 4 papers. Canis lupus familiaris (dog) cfa-miR-378 sequence is a product of cfa-miR-378, MIR378, miR-378 genes. Found in the dog reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACUGGACUUGGAGUCAGAAGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Bos taurus (cattle) bta-miR-378
    2. Callithrix jacchus cja-miR-378
    3. Capra hircus chi-miR-378-3p
    4. Cavia porcellus (domestic guinea pig) cpo-miR-378-3p
    5. Cervus elaphus (red deer) cel-miR-378
    6. Cricetulus griseus cgr-miR-378-3p
    7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-378-3p
    8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-378_3p (mature (guide))
    9. Homo sapiens hsa-miR-378a-3p
    10. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-378
    11. Macaca mulatta Mml-Mir-378_3p (mature (guide))
    12. Mus musculus (house mouse) Mmu-Mir-378_3p (mature (guide))
    13. Nomascus leucogenys nle-miR-378a
    14. Oryctolagus cuniculus (rabbit) ocu-miR-378-3p
    15. Otolemur garnettii oga-miR-378
    16. Pan paniscus ppa-miR-378a
    17. Papio hamadryas (hamadryas baboon) pha-miR-378
    18. Pteropus alecto pal-miR-378-3p
    19. Rattus norvegicus Rno-Mir-378_3p (mature (guide))
    20. Sus scrofa ssc-miR-378
    21. Tupaia chinensis tch-miR-378a-3p