Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-378a-3p URS00000451A1_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (LncBase, GeneCards, PSICQUIC, MirGeneDB, miRBase, RefSeq, MalaCards, IntAct, ENA, TarBase). Described in 70 papers. Homo sapiens (human) hsa-miR-378a-3p sequence is a product of MIR378A, miR-378a, miR-378, miR-378a-3p, hsa-miR-378a-3p, hsa-miR-378a genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3GAMMA, 14-3-3γ, 156DAG, 17b-HSD10, 182-FIP, 3'HEXO, 3-PAP, 3PAP, 53BP1, 82-FIP.

Interactions 3

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-378a-3p interacts with:

Interaction id Participant Synonyms
EBI-25750968 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
URS00000451A1_9606-0 O95760 O95760
URS00000451A1_9606-1 O95760 O95760

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACUGGACUUGGAGUCAGAAGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Bos taurus (cattle) bta-miR-378
    2. Callithrix jacchus cja-miR-378
    3. Canis lupus familiaris cfa-miR-378
    4. Capra hircus chi-miR-378-3p
    5. Cavia porcellus (domestic guinea pig) cpo-miR-378-3p
    6. Cervus elaphus (red deer) cel-miR-378
    7. Cricetulus griseus cgr-miR-378-3p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-378-3p
    9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-378_3p (mature (guide))
    10. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-378
    11. Macaca mulatta Mml-Mir-378_3p (mature (guide))
    12. Mus musculus (house mouse) Mmu-Mir-378_3p (mature (guide))
    13. Nomascus leucogenys nle-miR-378a
    14. Oryctolagus cuniculus (rabbit) ocu-miR-378-3p
    15. Otolemur garnettii oga-miR-378
    16. Pan paniscus ppa-miR-378a
    17. Papio hamadryas (hamadryas baboon) pha-miR-378
    18. Pteropus alecto pal-miR-378-3p
    19. Rattus norvegicus Rno-Mir-378_3p (mature (guide))
    20. Sus scrofa ssc-miR-378
    21. Tupaia chinensis tch-miR-378a-3p