Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) ppa-miR-378a URS00000451A1_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGACUUGGAGUCAGAAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Bos taurus (cattle) bta-miR-378
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-378
  3. Canis lupus familiaris (dog) cfa-miR-378
  4. Capra hircus chi-miR-378-3p
  5. Cavia porcellus cpo-miR-378-3p
  6. Cervus elaphus cel-miR-378
  7. Cricetulus griseus cgr-miR-378-3p
  8. Dasypus novemcinctus dno-miR-378-3p
  9. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-378_3p (mature (guide))
  10. Homo sapiens hsa-miR-378a-3p
  11. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-378
  12. Macaca mulatta (Rhesus monkey) Mml-Mir-378_3p (mature (guide))
  13. Mus musculus Mmu-Mir-378_3p (mature (guide))
  14. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-378a
  15. Oryctolagus cuniculus (rabbit) ocu-miR-378-3p
  16. Otolemur garnettii (small-eared galago) oga-miR-378
  17. Papio hamadryas (hamadryas baboon) pha-miR-378
  18. Pteropus alecto (black flying fox) pal-miR-378-3p
  19. Rattus norvegicus (Norway rat) Rno-Mir-378_3p (mature (guide))
  20. Sus scrofa ssc-miR-378
  21. Tupaia chinensis tch-miR-378a-3p
Publications