Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-378a URS00000451A1_61853

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Nomascus leucogenys. Annotated by 1 database (miRBase). Described in 0 papers. Found in the northern white-cheeked gibbon reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    ACUGGACUUGGAGUCAGAAGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 150 other species

    1. Bos taurus (cattle) bta-miR-378
    2. Callithrix jacchus cja-miR-378
    3. Canis lupus familiaris (dog) cfa-miR-378
    4. Capra hircus chi-miR-378-3p
    5. Cavia porcellus cpo-miR-378-3p
    6. Cervus elaphus (red deer) cel-miR-378
    7. Cricetulus griseus cgr-miR-378-3p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-378-3p
    9. Echinops telfairi Ete-Mir-378_3p (mature (guide))
    10. Homo sapiens (human) hsa-miR-378a-3p
    11. Ictidomys tridecemlineatus microRNA miR-378
    12. Macaca mulatta Mml-Mir-378_3p (mature (guide))
    13. Mus musculus Mmu-Mir-378_3p (mature (guide))
    14. Oryctolagus cuniculus (rabbit) ocu-miR-378-3p
    15. Otolemur garnettii oga-miR-378
    16. Pan paniscus (pygmy chimpanzee) ppa-miR-378a
    17. Papio hamadryas pha-miR-378
    18. Pteropus alecto (black flying fox) pal-miR-378-3p
    19. Rattus norvegicus Rno-Mir-378_3p (mature (guide))
    20. Sus scrofa ssc-miR-378
    21. Tupaia chinensis (Chinese tree shrew) tch-miR-378a-3p