Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Streptococcus gordonii 5S rRNA secondary structure diagram

Streptococcus gordonii 5S rRNA URS0000044945_1302

Automated summary: This rRNA sequence is 116 nucleotides long and is found in Streptococcus gordonii. Annotated by 3 databases (5SrRNAdb, ENA, RefSeq). Described in 3 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (5S_rRNA, RF00001). Streptococcus gordonii 5S rRNA sequence is a product of rrf gene.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUAAGUGACGAUAGCCUAGGAGAUACACCUGUACCCAUGCCGAACACAGCAGUUAAGCCCUAGAACGCCGGAAGUAGUUGGGGGUUGCCCCCUGUGAGAUAUGGUAGUCGCUUAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 16 other species

    1. Shigella flexneri 5S ribosomal RNA
    2. Streptococcus cuniculi 5S ribosomal RNA
    3. Streptococcus gordonii str. Challis substr. CH1 5S ribosomal RNA
    4. Streptococcus rubneri 5S ribosomal RNA
    5. Streptococcus salivarius 5S ribosomal RNA
    6. Streptococcus sanguinis 5S rRNA
    7. Streptococcus sanguinis OH0843 5S ribosomal RNA
    8. Streptococcus sanguinis SK36 5S ribosomal RNA
    9. Streptococcus sp. 2_1_36FAA 5S rRNA
    10. Streptococcus sp. FDAARGOS_146 5S ribosomal RNA
    11. Streptococcus sp. HMSC034B05 5S ribosomal RNA
    12. Streptococcus sp. HMSC062B01 5S ribosomal RNA
    13. Streptococcus sp. HMSC072C09 5S ribosomal RNA
    14. Streptococcus sp. HMSC10A01 5S ribosomal RNA
    15. Streptococcus sp. zg-36 5S ribosomal RNA
    16. Streptococcus sp. zg-70 5S ribosomal RNA
    17. Streptococcus sp. zg-86 5S ribosomal RNA
    2D structure New