Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Streptococcus gordonii str. Challis substr. CH1 5S ribosomal RNA secondary structure diagram

Streptococcus gordonii str. Challis substr. CH1 5S ribosomal RNA URS0000044945_467705

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAAGUGACGAUAGCCUAGGAGAUACACCUGUACCCAUGCCGAACACAGCAGUUAAGCCCUAGAACGCCGGAAGUAGUUGGGGGUUGCCCCCUGUGAGAUAUGGUAGUCGCUUAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Elizabethkingia anophelis 5S ribosomal RNA
  2. Shigella flexneri 5S ribosomal RNA
  3. Solobacterium sp. 5S ribosomal RNA
  4. Streptococcus cuniculi 5S ribosomal RNA
  5. Streptococcus gordonii 5S rRNA
  6. Streptococcus pneumoniae 5S ribosomal RNA
  7. Streptococcus rubneri 5S ribosomal RNA
  8. Streptococcus salivarius 5S ribosomal RNA
  9. Streptococcus sanguinis 5S rRNA
  10. Streptococcus sanguinis OH0843 5S ribosomal RNA
  11. Streptococcus sanguinis SK36 5S ribosomal RNA
  12. Streptococcus sp. 2_1_36FAA 5S rRNA
  13. Streptococcus sp. DTU_2020_1000888_1_SI_GRL_NUU_041A 5S ribosomal RNA
  14. Streptococcus sp. FDAARGOS_146 5S ribosomal RNA
  15. Streptococcus sp. HMSC034B05 5S ribosomal RNA
  16. Streptococcus sp. HMSC062B01 5S ribosomal RNA
  17. Streptococcus sp. HMSC072C09 5S ribosomal RNA
  18. Streptococcus sp. HMSC10A01 5S ribosomal RNA
  19. Streptococcus sp. SG1 5S ribosomal RNA
  20. Streptococcus sp. SG2 5S ribosomal RNA
  21. Streptococcus sp. SN3 5S ribosomal RNA
  22. Streptococcus sp. zg-36 5S ribosomal RNA
  23. Streptococcus sp. zg-70 5S ribosomal RNA
  24. Streptococcus sp. zg-86 5S ribosomal RNA
2D structure Publications