Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-339-5p URS000003FD55_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-339: Hsa-mir-339 is a microRNA that has been found to be up-expressed in VP and ART and down-expressed in EC and HIV- [PMC4165582]. It has been included in Taqman MicroRNA assays [PMC7697734]. The expression level of hsa-mir-339 did not change in relation to hsa-miR-221 [PMC4745707]. It has been suggested that novelMir-1 should be called a paralogue of hsa-mir-339 and labeled as hsa-mir-339_1 [PMC9580950]. The novelMir-1 has an identical seed as hsa-mir-339 but is mapped at a different genomic location [PMC9580950]. The precursor of hsa-mir-339 generates two miRNAs, miR-339-3p and miR-339-5p [PMC8799122]. In silico analysis has shown that the 3'UTR SNP is a putative microRNA binding site for hsa-mir-339, suggesting a functional role for this region of the gene related to mRNA expression of NRXN1 [PMC3110800]. Hsa-mir 339 has an almost perfect complementary miRNA/mRNA duplex with an extremely low free energy [-42,30 kcal/mol] [PMC2674674]. Hsa-miR 200a is another previously reported microRNA, but its relationship to hsa-miR 892b, hsa mir 3375p, and several other miRNAs including some from the mir30 family is not supported by evidence or references. Therefore, the claim that hsa-miR 200a is related to these miRNAs is false. However, the role of hsa-miR 200a and the other miRNAs mentioned remains unverified [PMC6497741].

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCUGUCCUCCAGGAGCUCACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-339-5p
  2. Cricetulus griseus (Chinese hamster) cgr-miR-339
  3. Dasypus novemcinctus (nine-banded armadillo) dno-miR-339-5p
  4. Echinops telfairi Ete-Mir-339_5p (mature (guide))
  5. Macaca mulatta (Rhesus monkey) mml-miR-339-5p
  6. Mus musculus mmu-miR-339-5p
  7. Pongo pygmaeus ppy-miR-339-5p
  8. Rattus norvegicus rno-miR-339-5p
Publications