Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cricetulus griseus (Chinese hamster) cgr-miR-181a-3p URS000003F252_10029

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCAUCGACCGUUGAUUGUACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Alligator mississippiensis (American alligator) ami-miR-181a-3p
  2. Cavia porcellus (domestic guinea pig) cpo-miR-181a-3p
  3. Cervus elaphus (red deer) cel-miR-181a-3p
  4. Chiloscyllium plagiosum microRNA cpl-miR-181a*
  5. Columba livia cli-miR-181a-3p
  6. Danio rerio (zebrafish) dre-miR-181a-3p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-181a-3p
  8. Gallus gallus gga-miR-181a-3p
  9. Gorilla gorilla gorilla ggo-miR-181a-3p (MIR181A-1)
  10. Gorilla gorilla (western gorilla) ggo-miR-181a-3p
  11. Homo sapiens (human) hsa-miR-181a-3p
  12. Lagothrix lagotricha lla-miR-181a-3p
  13. Macaca mulatta (Rhesus monkey) mml-miR-181a-3p
  14. Macaca nemestrina mne-miR-181a-3p
  15. Mus musculus mmu-miR-181a-1-3p
  16. Ornithorhynchus anatinus oan-miR-181a-1-3p
  17. Oryctolagus cuniculus (rabbit) ocu-miR-181a-3p
  18. Pan paniscus ppa-miR-181a-3p
  19. Pan troglodytes ptr-miR-181a-3p
  20. Pongo pygmaeus ppy-miR-181a-3p
  21. Pteropus alecto (black flying fox) pal-miR-181a-3p
  22. Rattus norvegicus rno-miR-181a-1-3p
  23. Taeniopygia guttata tgu-miR-181a-1-3p
  24. Takifugu rubripes (torafugu) fru-miR-181a-3p
  25. Tetraodon nigroviridis tni-miR-181a-3p
  26. Tor tambroides miR-181a-3p
Publications