Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-677 URS000003E6D1_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-677: Bta-mir-677 is a miRNA that has been investigated in several studies for its potential role in various biological processes. In one study, nine miRNAs, including bta-mir-677, were randomly selected for validation using RT-qPCR [PMC6876490]. Another study identified bta-mir-677 as one of the miRNAs involved in ceRNA regulatory networks [PMC7969984]. Furthermore, bta-mir-677 was found to be moderately expressed and significantly increased in macrophages infected with Mycobacterium avium subsp. paratuberculosis (MAP), suggesting its potential as a diagnostic biomarker for early MAP infection [PMC6600136]. The expression of bta-mir-677 was also found to be significantly upregulated in Brucella-positive samples compared to healthy controls [PMC7242893]. Additionally, the upregulation of bta-mir-677 was observed in response to FTA treatment and was found to target DEXH Asp-Glu-X-His box polypeptide 58 (DHX58), which is involved in pathogen recognition [PMC7943879]. In various studies, the upregulation of bta-mir-677 has been associated with the upregulation of target genes such as NR3C1 and DHX58 [PMC7242893] [PMC7943879]. The expression levels of bta-miR-205, bta-miR-708, and bta-miR-497 were also found to be correlated with that of bta-mir-677 in response to LPS+FTA treatment [PMC7943879]. Overall, these findings suggest that bta-mir-677 may play important roles in different biological processes and could serve as a potential biomarker or therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCACUGAUGAGCAGCUUCUGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Cervus elaphus (red deer) cel-miR-677
Publications