Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) chi-miR-141 URS000003E1A9_9925

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

chi-mir-141: Chi-mir-141 is a microRNA that was quantified using primers designed with miRprimer software [PMC5977473]. Target gene prediction analysis revealed that chi-mir-141, along with miR-141-x, miR-141-y, and miR-29-y, could regulate the expression of CSNK2A1, PCNA, PrKCB, YWHAB, and CDK6 genes [PMC8239366]. Among these microRNAs, chi-mir-141 and miR-141-y were found to target the most genes (four genes each), followed by chi-miR-20a-5p and miR-29-y [PMC8239366]. It was predicted that chi-mir-141 and the other identified microRNAs primarily play a role in regulating the proliferation and differentiation of SMG cells [PMC8239366]. In small follicles (Uni-S vs Mul-S), target prediction analysis identified seven significant microRNAs including chi-miR-200a (degree = 20), chi-mir-141 (degree = 20), chi-miR182 (degree = 16), chi-miR206 (degree = 10), chi-miR122 (degree = 7), chi-miRNA184 (degree = 2) and chi-miRNA1455p (degree = 1) [PMC7106838]. In large follicles (Uni-L vs Mul-L), the top differentially expressed microRNAs were found to be chi-mir-141 (degree = 17), chimi-R182(degree=13) chimi-R122(degree=12)and chimi-R154b3p(degree=12) [PMC7106838].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAACACUGUCUGGUAAAGAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Bos taurus (cattle) bta-miR-141
  2. Equus caballus (horse) eca-miR-141
  3. Homo sapiens (human) hsa-miR-141-3p
  4. Mus musculus (house mouse) mmu-miR-141-3p
  5. Ovis aries miscellaneous RNA
  6. Pan troglodytes (chimpanzee) ptr-miR-141
  7. Pteropus alecto pal-miR-141-3p
  8. Rattus norvegicus (Norway rat) rno-miR-141-3p
Publications