Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-141-3p URS000003E1A9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-141: Hsa-mir-141 is a microRNA that is found to be overexpressed in cisplatin resistant ovarian, gastric, and esophageal squamous cancer cells [PMC4682251]. In a study, gene expression levels of hsa-mir-141 were quantified using specific primers [PMC4981873]. The study used primers for hsa-mir-141 (#204504) and hsa-miR-200c (#2044852) from Exiqon [PMC4981873]. The overexpression of hsa-mir-141 in cisplatin resistant cancer cells suggests its potential role in drug resistance mechanisms [PMC4682251]. This microRNA may be involved in regulating gene expression and signaling pathways that contribute to resistance against cisplatin treatment [PMC4682251]. The quantification of gene expression levels using specific primers allows for the accurate measurement of hsa-mir-141 expression levels [PMC4981873]. This information can be valuable for understanding the mechanisms underlying drug resistance and developing targeted therapies to overcome it [PMC4981873]. Further research is needed to elucidate the specific targets and pathways regulated by hsa-mir-141 in cisplatin resistant cancer cells [PMC4682251]. Understanding the role of this microRNA can provide insights into potential therapeutic strategies for improving treatment outcomes in ovarian, gastric, and esophageal squamous cancers [PMC4682251].

mRNA interactions 7 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAACACUGUCUGGUAAAGAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Bos taurus (cattle) bta-miR-141
  2. Capra hircus chi-miR-141
  3. Equus caballus (horse) eca-miR-141
  4. Mus musculus mmu-miR-141-3p
  5. Ovis aries miscellaneous RNA
  6. Pan troglodytes ptr-miR-141
  7. Pteropus alecto (black flying fox) pal-miR-141-3p
  8. Rattus norvegicus rno-miR-141-3p
Publications