Automated summary: This lncRNA sequence is 423 nucleotides long and is found in Homo sapiens. Annotated by 6 databases (LNCipedia, HGNC, NONCODE, Ensembl/GENCODE, GeneCards, Ensembl). Described in 4 papers. Homo sapiens (human) long intergenic non-protein coding RNA 2373 (LINC02373) sequence is a product of NONHSAG011642.2, ENSG00000257507.1, LINC02373 genes. Found in the human reference genome.
According to LncBase, this RNA is targeted by the following miRNAs:
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AUUAAUGCCAUUAUCUCAGAAAUAGAGUUGUUAUCGUUGGAGUAGAAUCCUUAUAAAAGGAUGAGUUCAGCUCUGUUUUGUCUCUCUCACCCUCUCUUUGCCCUUCUGCCAUGGGAUGCUGUCCACCAUGGGAUGAUGCAGCAAGAAGGCCCUGGCAAGAUGCACUUUUCAAUCUUGGACUUCCCAGCCUCCAGAAGUGUGAGCCAAUAAAUCUCUGAGGGUUCUGUUCUAUGUCAUUUCCUUUGAAGUCAGUGGGAACUCUGUGCAGGACGGCAACAUGAACACCGGCCUCUAUACAUGAAGGCCAUCAAGUGGUUAACAUAUAGACAGUAUUUAAAUCCUUGGGACUGGAUGAGAUUACCAAGGGAGGAAAUGUAGAUGAAGGAGAAGAGAAAGGAUGGAGUUCUGGAGCACUACAAAUUU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.