v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-199a-5p URS0000554A4F_9606

mRNA interactions 21 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCAGUGUUCAGACUACCUGUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 61 other species

  1. Alligator mississippiensis Ami-Mir-199-P2-v1_5p* (star (passenger))
  2. Anolis carolinensis Aca-Mir-199-P3-v1_5p* (star (passenger))
  3. Bos taurus (domestic cattle) Bta-Mir-199-P3-v1_5p* (star (passenger))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-199-P3-v1_5p (mature (co-guide))
  5. Callorhinchus milii (elephant shark) Cmi-Mir-199-P2-v1_5p* (star (passenger))
  6. Canis lupus familiaris (dog) Cfa-Mir-199-P3-v1_5p* (star (passenger))
  7. Capra hircus (goat) chi-miR-199a-5p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-199-5p
  9. Cervus elaphus cel-miR-199a-5p
  10. Chrysemys picta bellii Cpi-Mir-199-P2-v1_5p* (star (passenger))
  11. Columba livia (rock pigeon) cli-miR-199-5p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-199a
  13. Cyprinus carpio ccr-miR-199-5p
  14. Danio rerio (zebrafish) dre-miR-199-5p
  15. Dasypus novemcinctus dno-miR-199-5p
  16. Echinops telfairi Ete-Mir-199-P3-v1_5p* (star (passenger))
  17. Eptatretus burgeri Ebu-Mir-199-P6_5p (mature (guide))
  18. Equus caballus (horse) eca-miR-199a-5p
  19. Gadus morhua (Atlantic cod) Gmo-Mir-199-P1b-v1_5p* (star (passenger))
  20. Gallus gallus (chicken) gga-miR-199-5p
  21. Gekko japonicus Gja-Mir-199-P1-v1_5p* (star (passenger))
  22. Gorilla gorilla gorilla ggo-miR-199a (MIR199A)
  23. Gorilla gorilla ggo-miR-199a
  24. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-199a
  25. Ictalurus punctatus (channel catfish) ipu-miR-199a-5p
  26. Lagothrix lagotricha lla-miR-199a
  27. Latimeria chalumnae (coelacanth) Lch-Mir-199-P2_5p* (star (passenger))
  28. Lepisosteus oculatus Loc-Mir-199-P2-v1_5p (mature (co-guide))
  29. Loxodonta africana (African savanna elephant) Laf-Mir-199-P3-v1_5p* (star (passenger))
  30. Macaca mulatta mml-miR-199a
  31. Macaca nemestrina (pig-tailed macaque) mne-miR-199a
  32. Microcaecilia unicolor Mun-Mir-199-P3-v1_5p* (star (passenger))
  33. Microcebus murinus (gray mouse lemur) Mmr-Mir-199-P3-v1_5p* (star (passenger))
  34. Monodelphis domestica Mdo-Mir-199-P1-v1_5p* (star (passenger))
  35. Monopterus albus (swamp eel) Mal-Mir-199-P3-v1_5p* (star (passenger))
  36. Mus musculus mmu-miR-199a-5p
  37. Notamacropus eugenii (tammar wallaby) Neu-Mir-199-P1-v1_5p* (star (passenger))
  38. Ophiophagus hannah (king cobra) oha-miR-199c-5p
  39. Ornithorhynchus anatinus (platypus) Oan-Mir-199-P1-v1_5p* (star (passenger))
  40. Oryctolagus cuniculus (rabbit) ocu-miR-199a-5p
  41. Ovis aries (sheep) miscellaneous RNA
  42. Pan paniscus (pygmy chimpanzee) ppa-miR-199a
  43. Pan troglodytes (chimpanzee) ptr-miR-199a-5p
  44. Petromyzon marinus pma-miR-199a-5p
  45. Pongo abelii (Sumatran orangutan) Pab-Mir-199-P3-v1_5p* (star (passenger))
  46. Pongo pygmaeus ppy-miR-199a
  47. Python bivittatus (Burmese python) Pbv-Mir-199-P3-v1_5p* (star (passenger))
  48. Rattus norvegicus (Norway rat) rno-miR-199a-5p
  49. Saguinus labiatus sla-miR-199a
  50. Salmo salar ssa-miR-199a-5p
  51. Sarcophilus harrisii Sha-Mir-199-P1-v1_5p* (star (passenger))
  52. Scyliorhinus torazame (cloudy catshark) Sto-Mir-199-P2-v1_5p* (star (passenger))
  53. Sphenodon punctatus (tuatara) Spt-Mir-199-P2_5p* (star (passenger))
  54. Sus scrofa ssc-miR-199a-5p
  55. Taeniopygia guttata Tgu-Mir-199-P2-v1_5p* (star (passenger))
  56. Takifugu rubripes fru-miR-199
  57. Tetraodon nigroviridis tni-miR-199
  58. Tor tambroides (Thai mahseer) miR-199-5p
  59. Tursiops truncatus miR-199a
  60. Xenopus laevis (African clawed frog) Xla-Mir-199-P1d-v1_5p* (star (passenger))
  61. Xenopus tropicalis (tropical clawed frog) xtr-miR-199a-5p
 Relationships

Molecular Relationships

 GoFlow Results Publications