Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-518c-5p URS000003B660_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-518c: Hsa-mir-518c is a microRNA that has been associated with the tumorigenesis of retinoblastomas [PMC2831057]. In a study, hsa-mir-518c was found to have anti-correlated mRNA levels for 50 genes in the 114 and 118 grouping [PMC4175465]. In a network of hub genes/miRNAs, hsa-mir-518c was found to be up-regulated and its target gene was COL1A1 [PMC7851075]. Alterations in hsa-mir-518c have also been observed in various eye diseases, such as retinoblastoma, where it is up-regulated [PMC8669721]. Over-expression of hsa-mir-518c has been observed in acute myeloid leukemia patients [PMC3347893]. In COLO 320 and COLO 205 cells, hsa-mir-518c was found to be up-regulated and involved in the regulation of cell cycle, cell differentiation, migration, and invasion [PMC9941246]. References: - [PMC2831057]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2831057/ - [PMC4175465]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4175465/ - [PMC7851075]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7851075/ - [PMC8669721]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8669721/ - [PMC3347893]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3347893/ - [PM9941246]: https://www.ncbi.nlm.nih.gov/pmc/articles/PM9941246/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCUGGAGGGAAGCACUUUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Gorilla gorilla gorilla ggo-miR-518c-5p (MIR518C)
  2. Gorilla gorilla (western gorilla) ggo-miR-518c-5p
Publications