Macaca mulatta (Rhesus monkey) mml-miR-107-5p URS0000035FEE_9544

• 23 nucleotides
• 3 databases (ENA, miRBase, RefSeq)
• Found in 11 other species
• 2864 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AGCUUCUUUACAGUGUUGCCUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

1. Cavia porcellus cpo-miR-107-5p
2. Chiloscyllium plagiosum microRNA cpl-miR-107-5p
3. Columba livia (rock pigeon) cli-miR-107-5p
4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-107-5p
5. Gallus gallus (chicken) gga-miR-107-5p
6. Mus musculus (house mouse) mmu-miR-107-5p
7. Oryctolagus cuniculus (rabbit) ocu-miR-107-5p
8. Pteropus alecto (black flying fox) pal-miR-107a-5p
9. Python bivittatus (Burmese python) pbv-miR-107-5p
10. Salmo salar ssa-miR-107-5p
11. Xenopus laevis (African clawed frog) xla-miR-107-5p

Publications Download

• FASTA
• JSON