Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-107-5p URS0000035FEE_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUUCUUUACAGUGUUGCCUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Cavia porcellus cpo-miR-107-5p
  2. Chiloscyllium plagiosum microRNA cpl-miR-107-5p
  3. Columba livia (rock pigeon) cli-miR-107-5p
  4. Dasypus novemcinctus dno-miR-107-5p
  5. Gallus gallus (chicken) gga-miR-107-5p
  6. Mus musculus (house mouse) mmu-miR-107-5p
  7. Oryctolagus cuniculus ocu-miR-107-5p
  8. Pteropus alecto pal-miR-107a-5p
  9. Python bivittatus pbv-miR-107-5p
  10. Salmo salar (Atlantic salmon) ssa-miR-107-5p
  11. Xenopus laevis xla-miR-107-5p
Publications