Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1787 (LINC01787) URS0000034673_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01787: LINC01787 is an oncogenic long non-coding RNA (lncRNA) that has been found to promote breast cancer (BC) cell proliferation, migration, and BC xenograft growth in vivo [PMC9969691]. It achieves this by repressing the maturation of miR-125b, a microRNA that is involved in regulating gene expression [PMC9969691]. Luciferase reporter assays have demonstrated that overexpression of LINC01787 increases the luciferase activities of reporters containing the 3'-UTR regions of KIAA1522, ETS1, or SNAI1 genes [PMC6848230]. These effects were found to be dependent on the binding sites of pre-miR-125b on LINC01787, as mutation of these binding sites abolished the increase in luciferase activity [PMC6848230]. Furthermore, in vivo studies have been conducted to investigate the effects of LINC01787 in breast cancer. These studies have provided evidence for its role in promoting BC growth and progression [PMC6848230]. Overall, these findings highlight the oncogenic potential of LINC01787 and its involvement in regulating gene expression and promoting breast cancer development.

Targeting miRNAs 1 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGAAUUACUCUGGAUUGUAAGCAAAUAUCUCUGGAAGAAAGGGAAAACUAAGUCAGAGCAGAAGGAGAAUUGAAAUGGUGAUGAGGACUGUGGAAGAUGAAGGCUUGGAACUGAGACCCCCUGGAAAAGACAGGCACUUGAAAGCCUAUUGCCUCAAAGAAAAGAAGGAUGUAUCCUCUAUCCAGCAAGCCUUUUUCAAUAAAAUCAUUAUGUACUCCACCUGCAACAAGGAAAGAAAACAAAGUUCCGUGAAUAACUAAAUCAUCAUAAUGAAGCAAAACGAUAAGCAGAAAGCAAGAGUGUUUUGAAAGCAUUGAUCACAAUAGCCAAGAAAUGAAGCAAUCCAGUAUCCAUCGAUAAAUGGAUGGAUAAAGAAAAUGUGGUACAUACAUACAACGGAAUAUUAUUCAGCCUUAACAAUGAAGGACAUCCGGACACAUGCUACAACAUGAAUGGACUUUGAAGACAUUAUGUUAAAAGCAAUAAGCAAAUCACAAUAGACAAAUACUAUAUGACAUAUGAUUCCACUUAUAUCAGGUACUUAGAGUAGUCACAUUCAUAAAGACAGAAAGUAGAAUGGUGGUUUCUCCGGGGAAGGGAAAGAGAGACUAGGGAGCUGUUGUUUAAUUUGUGAAAUCAAAAGAAUUUUGAAGAUUGCUUGCAUAACAUUGUGAAUAUAUGAACACUACUGAACUAUGUGCUUUAAAAUGGUUAAGUUAGUAAUGAACUAUAUGCUUAAAAAUGGUUAAGAUAGUAAAUUCUGUUAUUUUACUGAUGUUUUUUUCUCUUUCAAGUUUUAUUUUAGAAUCAAGGGGAACAUACACAGGUUUGUUACAAAAGUAUAUUGUUUGAUGCUGAGGUUUGAGGUAUGAUUGAAUCUGUCACCCCAUUAGUCAGCACAGUACUGAAUAGGUAGUUCUUCGGCCUUCACGACAGUUUUUUUAAAAGUACACAAACAAUUGUAGGUAUUUAAUUUGUUACUGUGCACAUGAAUAUACUAAACAGGAAAAGGUCACUAAGCUGUGGAUAUACACAUUGUUUACAGUUCAAUGAGAAUUGGCUUCUGUUGGCUAGCAAUAAAUGUCAAACUGUUCAACAUUGAUUAAUCAUGAAGGAAUAUUGCUUAACAAAGAAUAAAAUAUCUUUCUGAGGUUACAAGCAACAACUAGCUUUCUCUGACUUACUGAUUGACAUGAUGCAAAAUGCCUUCCCAGCCUCAGCAUCUGACUUAUAUGAUAUUCUAGUCACUUACAAAGAUGACAACUGUAUUAGUCCACUUUCAUGCUGCUGAUAAAGACAUACCUAAGACCGGCCAACUUACAAAAGAAAGAGCUUUAUUGGACUUACAGUUCCAUGUGGCUGGAGAAGCCACUCAGUGGCAGAAGGACAAGAUUUCAGGCACAUCUCACAUGGUGGAAGACGAGAGAAGAGAGCUUGUGUAGGGAAACUCCUGUUUUUAAAACCAUCAAAUCUCUUGAGACUUAUUCACUACCACGAGAGCAGCAUGGAAAAGACCUGCUCCCAUGAUUCAAUUACCUCCCACUGGGUCCCUCUCACAACACAUGGAAAUUCAAGAUGACAUUUGAGUGGGGACACAGCCAAACCAUAUCAACAACAGUCUUCCAGAUACUAGGUAAAGAAAAUCUGACCCAGUUUGUUAAGGUAUGUUUACUCCUUUAUCUUACCUUAUUGGAGGUAAGAUAAAAGAUAGGUAAGAUCUUACCUUAAGAUCAGGAAGGGUGGUUCAUAUAAUACCAGUAUGGCUUCCAAUUGGUAUACCCUUGUGGAUCUGAGGGAAGAAAUAAGAAUGUCUGCCCCAUAAGAAGCUAGGAGACAGAUUUUGGAGUCCCUGAGUCCCUGAGACCCUGACUUGGUUACAACAGCCAGAGAGAACUGUGGGAAUCCCUGAGAUGGCAGCCUCAUCUUAAAGGGUGAUUACUAGAGAUAAUAAGGGGGAGAAGCCUUGGUGAGCAUCCUGGACCAUUUUGGUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications