Automated summary: This snoRNA sequence is 66 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (Rfam, ENA, RefSeq, GeneCards, IntAct, Ensembl, snoDB, MalaCards, snOPY, HGNC). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (SNORD37, RF00440). Homo sapiens (human) small nucleolar RNA, C/D box 37 (SNORD37) sequence is a product of ENSG00000206775.1, SNORD37 genes. Found in the Homo sapiens reference genome.
According to IntAct, Homo sapiens (human) small nucleolar RNA, C/D box 37 (SNORD37) interacts with:
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AUUCGUGAUGACUGAUCAUUUCUUCACUUUGACCAGAUGUCUACUGAAGAAAGCCUGCGUCUGAGG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.