Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) ppa-miR-494 URS0000031935_9597

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Pan paniscus. Annotated by 2 databases (miRBase, RefSeq). Pan paniscus (pygmy chimpanzee) ppa-miR-494 sequence is a product of miR-494, ppa-miR-494, MIR494 genes. Found in the pygmy chimpanzee reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAAACAUACACGGGAAACCUCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 71 other species

    1. Bos taurus (cattle) Bta-Mir-154-P18_3p (mature (guide))
    2. Callithrix jacchus cja-miR-494
    3. Canis lupus familiaris (dog) Cfa-Mir-154-P18_3p (mature (guide))
    4. Capra hircus chi-miR-494
    5. Cavia porcellus cpo-miR-494-3p
    6. Cervus elaphus (red deer) cel-miR-494
    7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-494-3p
    8. Eptesicus fuscus efu-miR-494
    9. Homo sapiens (human) Hsa-Mir-154-P18_3p (mature (guide))
    10. Macaca mulatta Mml-Mir-154-P18_3p (mature (guide))
    11. Mus musculus Mmu-Mir-154-P18_3p (mature (guide))
    12. Ovis aries oar-miR-494-3p
    13. Rattus norvegicus rno-miR-494-3p
    14. Sus scrofa ssc-mir19
    Publications New