Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) Bta-Mir-154-P18_3p (mature (guide)) URS0000031935_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-154: The SNP g.1536C > T in the TNP2 3′-UTR, which alters the binding of TNP2 with bta-mir-154, is associated with the semen quality traits of Chinese Holstein bulls [PMC4863368]. The SNP g.1536C > T is located within the bta-mir-154 binding site [PMC3885562]. Bioinformatics predictions indicate that TNP2 is one of the target genes of bta-mir-154 [PMC3885562]. The inhibitory effects of bta-mir-154 on TNP2 expression are observed through direct binding to the TNP2 3′-UTR with g.1536C > T-T, while no binding is observed in the g.1536C > T-C SNP mutation [PMC3885562]. Bta-mir-154 expression is male-specific and upregulated 1.4-fold in adult bull testicular tissues compared to fetal bull testicular tissues [PMC3885562]. The effect of bta-mir-154 on TNP2 activity was tested using a one-way ANOVA [PMC3885562].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAAACAUACACGGGAAACCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species