Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 44 (SNORA44) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 44 (SNORA44) URS000002FDBC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA44: SNORA44 is an H/ACA-type snoRNA that has been found to be significantly correlated with PD-L1 expression in lower grade gliomas, prostate adenocarcinoma, thyroid carcinoma, and thymoma [PMC6294694]. Exposure to benzene has been shown to downregulate SNORA44 [PMC5531504]. SNORA44 is part of a group of snoRNAs that have high CNRQ values at standard fixation conditions and low CNRQ values at overfixation conditions [PMC6308291]. Knockdown of SNHG12 in hepatocellular carcinoma does not significantly affect the expression of SNORA44 [PMC7154078]. The length of SNORA44 is 117 nt [PMC5531504]. In a study by Lan et al., the expression of SNORD99 and SNORA44 (HBII-420 and ACA44, respectively) was assessed [PMC5560661]. SNORA44 is an H/ACA-type snoRNA that has been found to be significantly correlated with PD-L1 expression in lower grade gliomas, prostate adenocarcinoma, thyroid carcinoma, and thymoma (Figure 4c) [PMC6294694]. Exposure to benzene has been shown to downregulate two ncRNAs: NR_034050 (SNORA44) and NR_102360 (Zbtb24_v4) [PMC5531504]. There are two groups of targets: one group with overall stable CNRQ values including HSA-LET-7A, HSA-LET-7D, HSA-LET-7E, HSA-MIR-103, HSA-MIR-107, HSA-MIR-1251, HSA-MIR-1260, HSA-MIR-154,HSA-MIR17,HSA-MIR27A,HAS-MIR320C,HSA-MIR326,HSA-MIR339-5P,HSA-MIR4279, and HSA-MIR720, and one group with high CNRQ values at standard fixation conditions and low CNRQ values at overfixation conditions including RNU12, RNU2-1, SCARNA5, SNORA16A, SNORA44, SNORA61, and SNORD99 [PMC6308291]. SNHG12 knockdown in hepatocellular carcinoma does not significantly affect the expression of snoRNAs including SNORA44 [PMC7154078]. The length of SNORA44 is 117 nt [PMC5531504]. In a study by Lan et al., the expression of HBII-420 (SNORD99) and ACA44 (SNORA44) was assessed [PMC5560661].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCAUGUUUCCAAGGGCUGUGGCUGGUCAUAGCCAUGGGAUCUCCAACUGCAUGCAAGAGCAACCUGGAAAGACUUUGACAGCGCAGGUCAGUACAAUACCUGCAAGCUGCCACUCAGCUUUCCUAUAAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications