Gorilla gorilla gorilla (Western Lowland Gorilla) small nucleolar RNA, H/ACA box 44 (ENSGGOG00000030022.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (Western Lowland Gorilla) small nucleolar RNA, H/ACA box 44 (ENSGGOG00000030022.2) URS000002FDBC_9595

132 nucleotides
2 databases (Ensembl, Rfam)
Found in 4 other species
34 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CAGCAUGUUUCCAAGGGCUGUGGCUGGUCAUAGCCAUGGGAUCUCCAACUGCAUGCAAGAGCAACCUGGAAAGACUUUGACAGCGCAGGUCAGUACAAUACCUGCAAGCUGCCACUCAGCUUUCCUAUAAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Homo sapiens small nucleolar RNA, H/ACA box 44 (SNORA44)
Pan paniscus (bonobo) small nucleolar RNA, H/ACA box 44 (ENSPPAG00000006695.1)
Pan troglodytes small nucleolar RNA, H/ACA box 44 (ENSPTRG00000024559.2)
Pongo abelii (Sumatran orangutan) Small nucleolar RNA SNORA44

2D structure

Publications