v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
tRNAGln from synthetic construct (PDB 3AL0, chain E) secondary structure diagram

tRNAGln from synthetic construct (PDB 3AL0, chain E) URS000002EA11_32630

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGGGAGGUCGUCUAACGGUAGGACGGCGGACUCUGGAUCCGCUGGUGGAGGUUCGAGUCCUCCCCUCCCAGCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 21 other species

    1. Thermotoga maritima MSB8 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    2. Thermotoga maritima tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    3. Thermotoga neapolitana DSM 4359 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    4. Thermotoga neapolitana LA10 tRNA-Gln
    5. Thermotoga neapolitana (metagenome) tRNA-Gln
    6. Thermotoga petrophila RKU-10 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    7. Thermotoga petrophila RKU-1 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    8. Thermotoga petrophila (terrestrial metagenome) tRNA-Gln
    9. Thermotoga sp. 2812B tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    10. Thermotoga sp. 38H-to tRNA-Gln
    11. Thermotoga sp. Cell2 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    12. Thermotoga sp. EMP tRNA-Gln
    13. Thermotoga sp. (hot springs metagenome) tRNA-Gln
    14. Thermotoga sp. KOL6 tRNA-Gln
    15. Thermotoga sp. Mc24 tRNA-Gln
    16. Thermotoga sp. RQ2 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    17. Thermotoga sp. RQ7 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    18. Thermotoga sp. SG1 tRNA-Gln
    19. Thermotoga sp. TBGT1765 tRNA-Gln
    20. Thermotoga sp. TBGT1766 tRNA-Gln
    21. Thermotoga sp. Xyl54 tRNA-Gln
     2D structure Publications