Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Thermotoga sp. RQ7 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1) secondary structure diagram

Thermotoga sp. RQ7 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1) URS000002EA11_126738

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGAGGUCGUCUAACGGUAGGACGGCGGACUCUGGAUCCGCUGGUGGAGGUUCGAGUCCUCCCCUCCCAGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Thermotoga maritima MSB8 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  2. Thermotoga maritima tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  3. Thermotoga neapolitana DSM 4359 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  4. Thermotoga neapolitana LA10 tRNA-Gln
  5. Thermotoga neapolitana (metagenome) tRNA-Gln
  6. Thermotoga petrophila RKU-10 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  7. Thermotoga petrophila RKU-1 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  8. Thermotoga petrophila tRNA-Gln
  9. Thermotoga sp. 2812B tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  10. Thermotoga sp. 38H-to tRNA-Gln
  11. Thermotoga sp. Cell2 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  12. Thermotoga sp. EMP tRNA-Gln
  13. Thermotoga sp. (hot springs metagenome) tRNA-Gln
  14. Thermotoga sp. KOL6 tRNA-Gln
  15. Thermotoga sp. Mc24 tRNA-Gln
  16. Thermotoga sp. RQ2 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
  17. Thermotoga sp. SG1 tRNA-Gln
  18. Thermotoga sp. TBGT1765 tRNA-Gln
  19. Thermotoga sp. TBGT1766 tRNA-Gln
  20. Thermotoga sp. Xyl54 tRNA-Gln
  21. synthetic construct tRNAGln from synthetic construct (PDB 3AL0, chain E)
2D structure