Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Thermotoga maritima tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1) secondary structure diagram

Thermotoga maritima tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1) URS000002EA11_2336

Automated summary: This tRNA sequence is 74 nucleotides long and is found in Thermotoga maritima. Annotated by 3 databases (GtRNAdb, PDBe, ENA). Described in 5 papers. Has a conserved secondary structure or a structured region. Has an experimentally determined 3D structure. Matches 1 Rfam family (tRNA, RF00005). Thermotoga maritima tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1) sequence is a product of tRNA-Gln-CTG-1-1 gene.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGGAGGUCGUCUAACGGUAGGACGGCGGACUCUGGAUCCGCUGGUGGAGGUUCGAGUCCUCCCCUCCCAGCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Thermotoga maritima MSB8 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    2. Thermotoga naphthophila RKU-10 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    3. Thermotoga naphthophila tRNA-Gln
    4. Thermotoga neapolitana DSM 4359 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    5. Thermotoga neapolitana LA10 tRNA-Gln
    6. Thermotoga neapolitana tRNA-Gln
    7. Thermotoga petrophila RKU-1 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    8. Thermotoga sp. 2812B tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    9. Thermotoga sp. 38H-to tRNA-Gln
    10. Thermotoga sp. Cell2 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    11. Thermotoga sp. EMP tRNA-Gln
    12. Thermotoga sp. tRNA-Gln
    13. Thermotoga sp. KOL6 tRNA-Gln
    14. Thermotoga sp. Mc24 tRNA-Gln
    15. Thermotoga sp. RQ2 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    16. Thermotoga sp. RQ7 tRNA-Gln (CTG) (tRNA-Gln-CTG-1-1)
    17. Thermotoga sp. SG1 tRNA-Gln
    18. Thermotoga sp. TBGT1765 tRNA-Gln
    19. Thermotoga sp. TBGT1766 tRNA-Gln
    20. Thermotoga sp. Xyl54 tRNA-Gln
    21. synthetic construct tRNAGln from synthetic construct (PDB 3AL0, chain E)
    2D structure New