Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-199b URS0000029EBD_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-199b: Bta-mir-199b is a microRNA that has been associated with various biological processes and conditions. It has been found to be associated with a bacterial cluster comprising Prevotella, Bacteroides, Ruminococcus, Propionibacterium, and Klebsiella [PMC6708143]. Bta-mir-199b is one of the microRNAs that show differential expression between preadipocytes and adipocytes [PMC7278844]. It has also been found to be expressed at higher levels in rumen tissue [PMC6720277]. Studies on rumen development in calves have shown that the expression of bta-mir-199b changes before and after weaning [PMC6720277]. Bta-mir-199b has been found to exhibit a strong and positive association with bta-miR-29a, SUGT1, and PPID [PMC8273763]. It is also associated with uterine proteins in network analysis [PMC8273763]. In addition, bta-mir-199b has been shown to target up-regulated genes in the turquoise module [PMC8759604]. It is one of the downregulated miRNAs at parturition [PMC9445238]. Furthermore, bta-mir-199b may relieve the inhibition effects of IKKβ to trigger NF-κB signaling [PMC9260119]. References: [PMC6708143] [PMC7278844] [PMC6720277] [PMC8273763] [PMC8759604] [PM9445238] [PM9260119]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCAGUGUUUAGACUAUCUGUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Capra hircus chi-miR-199c-5p
  2. Cavia porcellus (domestic guinea pig) cpo-miR-199-3-5p
  3. Cervus elaphus cel-miR-199b
  4. Dasypus novemcinctus dno-miR-199-2-5p
  5. Equus caballus (horse) eca-miR-199b-5p
  6. Homo sapiens (human) hsa-miR-199b-5p
  7. Macaca fascicularis microRNA miR-199b-5p
  8. Monodelphis domestica (gray short-tailed opossum) mdo-miR-199b-1-5p
  9. Tursiops truncatus miR-199b
Publications