Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tursiops truncatus (common bottlenose dolphin) miR-199b URS0000029EBD_9739

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCAGUGUUUAGACUAUCUGUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Bos taurus bta-miR-199b
  2. Capra hircus chi-miR-199c-5p
  3. Cavia porcellus (domestic guinea pig) cpo-miR-199-3-5p
  4. Cervus elaphus cel-miR-199b
  5. Dasypus novemcinctus dno-miR-199-2-5p
  6. Equus caballus (horse) eca-miR-199b-5p
  7. Homo sapiens (human) hsa-miR-199b-5p
  8. Macaca fascicularis microRNA miR-199b-5p
  9. Monodelphis domestica (gray short-tailed opossum) mdo-miR-199b-1-5p