Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) xtr-miR-203 URS0000028BBC_8364

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Xenopus tropicalis. Annotated by 4 databases (MirGeneDB, miRBase, RefSeq, PirBase). Described in 3 papers. Xenopus tropicalis (tropical clawed frog) xtr-miR-203 sequence is a product of mir203, miR-203, xtr-miR-203 genes. Found in the tropical clawed frog reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUGAAAUGUUUAGGACCACUUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Alligator mississippiensis Ami-Mir-203-v1_3p (mature (guide))
    2. Anolis carolinensis (green anole) aca-miR-203-3p
    3. Chrysemys picta bellii (western painted turtle) Cpi-Mir-203-v1_3p (mature (guide))
    4. Cyprinus carpio ccr-miR-203a
    5. Danio rerio (zebrafish) dre-miR-203a-3p
    6. Gadus morhua gmo-miR-203a-3p
    7. Gallus gallus (chicken) gga-miR-203a
    8. Haplochromis burtoni abu-miR-203
    9. Maylandia zebra (zebra mbuna) mze-miR-203
    10. Monodelphis domestica mdo-miR-203
    11. Neolamprologus brichardi nbr-miR-203
    12. Ophiophagus hannah oha-miR-203-3p
    13. Ornithorhynchus anatinus Oan-Mir-203-v1_3p (mature (guide))
    14. Oryzias latipes (Japanese medaka) ola-miR-203
    15. Paralichthys olivaceus pol-miR-203-3p
    16. Petromyzon marinus pma-miR-203b-3p
    17. Python bivittatus pbv-miR-203-3p
    18. Salmo salar ssa-miR-203a-3p
    19. Scyliorhinus torazame Sto-Mir-203-v1_3p (mature (guide))
    20. Taeniopygia guttata (zebra finch) tgu-miR-203-3p
    21. Takifugu rubripes fru-miR-203
    22. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-203
    23. Tor tambroides (Thai mahseer) miR-203a-3p
    24. Xenopus laevis xla-miR-203-3p