v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus tropicalis (tropical clawed frog) xtr-miR-203 URS0000028BBC_8364

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    GUGAAAUGUUUAGGACCACUUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 31 other species

    1. Alligator mississippiensis Ami-Mir-203-v1_3p (mature (guide))
    2. Anolis carolinensis aca-miR-203-3p
    3. Callorhinchus milii Cmi-Mir-203-P5-v1_3p (mature (guide))
    4. Chrysemys picta bellii (western painted turtle) Cpi-Mir-203-v1_3p (mature (guide))
    5. Cyprinus carpio (common carp) ccr-miR-203a
    6. Danio rerio (zebrafish) dre-miR-203a-3p
    7. Gadus morhua (Atlantic cod) gmo-miR-203a-3p
    8. Gallus gallus (chicken) gga-miR-203a
    9. Gekko japonicus Gja-Mir-203-v1_3p (mature (guide))
    10. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-203
    11. Latimeria chalumnae (coelacanth) Lch-Mir-203_3p (mature (guide))
    12. Lepisosteus oculatus Loc-Mir-203-v1_3p (mature (guide))
    13. Maylandia zebra mze-miR-203
    14. Microcaecilia unicolor Mun-Mir-203-v1_3p (mature (guide))
    15. Monodelphis domestica mdo-miR-203
    16. Monopterus albus (swamp eel) Mal-Mir-203-P1-v1_3p (mature (guide))
    17. Neolamprologus brichardi nbr-miR-203
    18. Ophiophagus hannah oha-miR-203-3p
    19. Ornithorhynchus anatinus Oan-Mir-203-v1_3p (mature (guide))
    20. Oryzias latipes (Japanese medaka) ola-miR-203
    21. Paralichthys olivaceus (Japanese flounder) pol-miR-203-3p
    22. Petromyzon marinus pma-miR-203b-3p
    23. Python bivittatus (Burmese python) pbv-miR-203-3p
    24. Salmo salar (Atlantic salmon) ssa-miR-203a-3p
    25. Scyliorhinus torazame Sto-Mir-203-v1_3p (mature (guide))
    26. Sphenodon punctatus Spt-Mir-203_3p (mature (guide))
    27. Taeniopygia guttata tgu-miR-203-3p
    28. Takifugu rubripes fru-miR-203
    29. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-203
    30. Tor tambroides miR-203a-3p
    31. Xenopus laevis (African clawed frog) xla-miR-203-3p
     Publications