Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus laevis (African clawed frog) xla-miR-203-3p URS0000028BBC_8355

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAAAUGUUUAGGACCACUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Alligator mississippiensis Ami-Mir-203-v1_3p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-203-3p
  3. Callorhinchus milii Cmi-Mir-203-P5-v1_3p (mature (guide))
  4. Chrysemys picta bellii (western painted turtle) Cpi-Mir-203-v1_3p (mature (guide))
  5. Cyprinus carpio (common carp) ccr-miR-203a
  6. Danio rerio dre-miR-203a-3p
  7. Gadus morhua gmo-miR-203a-3p
  8. Gallus gallus gga-miR-203a
  9. Gekko japonicus Gja-Mir-203-v1_3p (mature (guide))
  10. Haplochromis burtoni abu-miR-203
  11. Latimeria chalumnae Lch-Mir-203_3p (mature (guide))
  12. Lepisosteus oculatus Loc-Mir-203-v1_3p (mature (guide))
  13. Maylandia zebra mze-miR-203
  14. Microcaecilia unicolor Mun-Mir-203-v1_3p (mature (guide))
  15. Monodelphis domestica (gray short-tailed opossum) mdo-miR-203
  16. Monopterus albus (swamp eel) Mal-Mir-203-P1-v1_3p (mature (guide))
  17. Neolamprologus brichardi (lyretail cichlid) nbr-miR-203
  18. Ophiophagus hannah oha-miR-203-3p
  19. Ornithorhynchus anatinus Oan-Mir-203-v1_3p (mature (guide))
  20. Oryzias latipes ola-miR-203
  21. Paralichthys olivaceus (Japanese flounder) pol-miR-203-3p
  22. Petromyzon marinus (sea lamprey) pma-miR-203b-3p
  23. Python bivittatus (Burmese python) pbv-miR-203-3p
  24. Salmo salar (Atlantic salmon) ssa-miR-203a-3p
  25. Scyliorhinus torazame (cloudy catshark) Sto-Mir-203-v1_3p (mature (guide))
  26. Sphenodon punctatus (tuatara) Spt-Mir-203_3p (mature (guide))
  27. Taeniopygia guttata tgu-miR-203-3p
  28. Takifugu rubripes fru-miR-203
  29. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-203
  30. Tor tambroides miR-203a-3p
  31. Xenopus tropicalis (tropical clawed frog) xtr-miR-203