Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-203a-3p URS0000028BBC_7955

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAAAUGUUUAGGACCACUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Alligator mississippiensis Ami-Mir-203-v1_3p (mature (guide))
  2. Anolis carolinensis aca-miR-203-3p
  3. Callorhinchus milii Cmi-Mir-203-P5-v1_3p (mature (guide))
  4. Chrysemys picta bellii (western painted turtle) Cpi-Mir-203-v1_3p (mature (guide))
  5. Cyprinus carpio ccr-miR-203a
  6. Gadus morhua (Atlantic cod) gmo-miR-203a-3p
  7. Gallus gallus (chicken) gga-miR-203a
  8. Gekko japonicus Gja-Mir-203-v1_3p (mature (guide))
  9. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-203
  10. Latimeria chalumnae (coelacanth) Lch-Mir-203_3p (mature (guide))
  11. Lepisosteus oculatus (spotted gar) Loc-Mir-203-v1_3p (mature (guide))
  12. Maylandia zebra (zebra mbuna) mze-miR-203
  13. Microcaecilia unicolor Mun-Mir-203-v1_3p (mature (guide))
  14. Monodelphis domestica (gray short-tailed opossum) mdo-miR-203
  15. Monopterus albus (swamp eel) Mal-Mir-203-P1-v1_3p (mature (guide))
  16. Neolamprologus brichardi nbr-miR-203
  17. Ophiophagus hannah (king cobra) oha-miR-203-3p
  18. Ornithorhynchus anatinus (platypus) Oan-Mir-203-v1_3p (mature (guide))
  19. Oryzias latipes ola-miR-203
  20. Paralichthys olivaceus pol-miR-203-3p
  21. Petromyzon marinus pma-miR-203b-3p
  22. Python bivittatus pbv-miR-203-3p
  23. Salmo salar ssa-miR-203a-3p
  24. Scyliorhinus torazame (cloudy catshark) Sto-Mir-203-v1_3p (mature (guide))
  25. Sphenodon punctatus (tuatara) Spt-Mir-203_3p (mature (guide))
  26. Taeniopygia guttata (zebra finch) tgu-miR-203-3p
  27. Takifugu rubripes fru-miR-203
  28. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-203
  29. Tor tambroides (Thai mahseer) miR-203a-3p
  30. Xenopus laevis xla-miR-203-3p
  31. Xenopus tropicalis (tropical clawed frog) xtr-miR-203
Publications