Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anolis carolinensis (green anole) aca-miR-203-3p URS0000028BBC_28377

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Anolis carolinensis. Annotated by 3 databases (miRBase, MirGeneDB, RefSeq). Described in 4 papers. Anolis carolinensis (green anole) aca-miR-203-3p sequence is a product of miR-203-3p, aca-miR-203-3p, aca-miR-203, mir203, miR-203 genes. Found in the green anole reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GUGAAAUGUUUAGGACCACUUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 178 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-203-v1_3p (mature (guide))
    2. Callorhinchus milii (elephant shark) Cmi-Mir-203-P5-v1_3p (mature (guide))
    3. Chrysemys picta bellii Cpi-Mir-203-v1_3p (mature (guide))
    4. Cyprinus carpio ccr-miR-203a
    5. Danio rerio (zebrafish) dre-miR-203a-3p
    6. Gadus morhua gmo-miR-203a-3p
    7. Gallus gallus (chicken) gga-miR-203a
    8. Gekko japonicus Gja-Mir-203-v1_3p (mature (guide))
    9. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-203
    10. Latimeria chalumnae (coelacanth) Lch-Mir-203_3p (mature (guide))
    11. Lepisosteus oculatus (spotted gar) Loc-Mir-203-v1_3p (mature (guide))
    12. Maylandia zebra (zebra mbuna) mze-miR-203
    13. Microcaecilia unicolor Mun-Mir-203-v1_3p (mature (guide))
    14. Monodelphis domestica mdo-miR-203
    15. Monopterus albus (swamp eel) Mal-Mir-203-P1-v1_3p (mature (guide))
    16. Neolamprologus brichardi nbr-miR-203
    17. Ophiophagus hannah oha-miR-203-3p
    18. Ornithorhynchus anatinus Oan-Mir-203-v1_3p (mature (guide))
    19. Oryzias latipes (Japanese medaka) ola-miR-203
    20. Paralichthys olivaceus pol-miR-203-3p
    21. Petromyzon marinus pma-miR-203b-3p
    22. Python bivittatus (Burmese python) pbv-miR-203-3p
    23. Salmo salar (Atlantic salmon) ssa-miR-203a-3p
    24. Scyliorhinus torazame Sto-Mir-203-v1_3p (mature (guide))
    25. Sphenodon punctatus Spt-Mir-203_3p (mature (guide))
    26. Taeniopygia guttata (zebra finch) tgu-miR-203-3p
    27. Takifugu rubripes (torafugu) fru-miR-203
    28. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-203
    29. Tor tambroides miR-203a-3p
    30. Xenopus laevis xla-miR-203-3p
    31. Xenopus tropicalis xtr-miR-203
    Publications New