Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Selenomonas ruminantium subsp. lactilytica TAM6421 5S ribosomal RNA secondary structure diagram

Selenomonas ruminantium subsp. lactilytica TAM6421 5S ribosomal RNA URS000002846C_927704

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAGUGACGAUAGCUGAGUGGUUCCACCUGUUCCCAUACCGAACACAGUAGUUAAGCACUCAUACGCCGAAAGUACUUGUCUGGAGACGGACUGGGAGGAUAGGGCGUUGCUGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Selenomonas sp. 5S ribosomal RNA
2D structure Publications