Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-338-3p URS00000254A6_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 7 databases (RefSeq, LncBase, ENA, TarBase, MalaCards, GeneCards, miRBase). Homo sapiens (human) hsa-miR-338-3p sequence is a product of MIR338, miR-338, miR-338-3p, hsa-miR-338-3p, hsa-miR-338 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 101F10.1, 12CC4, 182-FIP, 2PP2A, 3pK, 5PTASE, 6.3, 82-FIP, 8B, A1U.

Interactions 4

According to PSICQUIC, Homo sapiens (human) hsa-miR-338-3p interacts with:

Interaction id Participant Synonyms
URS00000254A6_9606-0 P78536 P78536
URS00000254A6_9606-2 P78536 P78536
URS00000254A6_9606-1 Q99835 Q99835
URS00000254A6_9606-3 Q99835 Q99835

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCCAGCAUCAGUGAUUUUGUUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 26 other species

    1. Alligator mississippiensis (American alligator) ami-miR-338-3p
    2. Callorhinchus milii eshark_mir-338_1
    3. Cyprinus carpio ccr-miR-338
    4. Danio rerio (zebrafish) dre-miR-338
    5. Equus caballus (horse) eca-miR-338-3p
    6. Gadus morhua gmo-miR-338-3p
    7. Haplochromis burtoni abu-miR-338
    8. Ictalurus punctatus (channel catfish) ipu-miR-338
    9. Macaca mulatta (Rhesus monkey) mml-miR-338-3p
    10. Maylandia zebra (zebra mbuna) mze-miR-338
    11. Mus musculus (house mouse) mmu-miR-338-3p
    12. Neolamprologus brichardi nbr-miR-338
    13. Oreochromis niloticus oni-miR-338
    14. Pan troglodytes ptr-miR-338
    15. Pongo pygmaeus (Bornean orangutan) ppy-miR-338-3p
    16. Pundamilia nyererei pny-miR-338
    17. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63002
    18. Salmo salar ssa-miR-338a-3p
    19. Sarcophilus harrisii sha-miR-338
    20. Sus scrofa (pig) ssc-miR-338
    21. Taeniopygia guttata (zebra finch) tgu-miR-338-3p
    22. Takifugu rubripes fru-miR-338
    23. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-338
    24. Tor tambroides (Thai mahseer) miR-338
    25. Xenopus laevis xla-miR-338
    26. Xenopus tropicalis (tropical clawed frog) xtr-miR-338
    Publications New