Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-338 URS00000254A6_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 3 databases (miRBase, RefSeq, ENA). Danio rerio (zebrafish) dre-miR-338 sequence is a product of dre-mir-338-2, dre-mir-338-1, miR-338, dre-miR-338 genes. Found in the Danio rerio reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCCAGCAUCAGUGAUUUUGUUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 26 other species

    1. Alligator mississippiensis ami-miR-338-3p
    2. Callorhinchus milii eshark_mir-338_1
    3. Cyprinus carpio (common carp) ccr-miR-338
    4. Equus caballus (horse) eca-miR-338-3p
    5. Gadus morhua gmo-miR-338-3p
    6. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-338
    7. Homo sapiens hsa-miR-338-3p
    8. Ictalurus punctatus ipu-miR-338
    9. Macaca mulatta mml-miR-338-3p
    10. Maylandia zebra mze-miR-338
    11. Mus musculus mmu-miR-338-3p
    12. Neolamprologus brichardi nbr-miR-338
    13. Oreochromis niloticus oni-miR-338
    14. Pan troglodytes (chimpanzee) ptr-miR-338
    15. Pongo pygmaeus (Bornean orangutan) ppy-miR-338-3p
    16. Pundamilia nyererei pny-miR-338
    17. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63002
    18. Salmo salar ssa-miR-338a-3p
    19. Sarcophilus harrisii (Tasmanian devil) sha-miR-338
    20. Sus scrofa (pig) ssc-miR-338
    21. Taeniopygia guttata (zebra finch) tgu-miR-338-3p
    22. Takifugu rubripes fru-miR-338
    23. Tetraodon nigroviridis tni-miR-338
    24. Tor tambroides (Thai mahseer) miR-338
    25. Xenopus laevis (African clawed frog) xla-miR-338
    26. Xenopus tropicalis xtr-miR-338
    Publications