Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Takifugu rubripes (torafugu) fru-miR-338 URS00000254A6_31033

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCAGCAUCAGUGAUUUUGUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 26 other species

  1. Alligator mississippiensis ami-miR-338-3p
  2. Callorhinchus milii eshark_mir-338_1
  3. Cyprinus carpio ccr-miR-338
  4. Danio rerio dre-miR-338
  5. Equus caballus eca-miR-338-3p
  6. Gadus morhua (Atlantic cod) gmo-miR-338-3p
  7. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-338
  8. Homo sapiens hsa-miR-338-3p
  9. Ictalurus punctatus (channel catfish) ipu-miR-338
  10. Macaca mulatta (Rhesus monkey) mml-miR-338-3p
  11. Maylandia zebra (zebra mbuna) mze-miR-338
  12. Mus musculus (house mouse) mmu-miR-338-3p
  13. Neolamprologus brichardi nbr-miR-338
  14. Oreochromis niloticus oni-miR-338
  15. Pan troglodytes (chimpanzee) ptr-miR-338
  16. Pongo pygmaeus (Bornean orangutan) ppy-miR-338-3p
  17. Pundamilia nyererei pny-miR-338
  18. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63002
  19. Salmo salar ssa-miR-338a-3p
  20. Sarcophilus harrisii sha-miR-338
  21. Sus scrofa (pig) ssc-miR-338
  22. Taeniopygia guttata (zebra finch) tgu-miR-338-3p
  23. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-338
  24. Tor tambroides (Thai mahseer) miR-338
  25. Xenopus laevis xla-miR-338
  26. Xenopus tropicalis (tropical clawed frog) xtr-miR-338
Publications