Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Pro (CCN) (MT-TP) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Pro (CCN) (MT-TP) URS000002176F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TP: MT-TP is a tRNA gene that shows the presence of variants [PMC8365099]. In the non-obese group, five SNPs were detected, including MT:10499A > G, MT:10609T > C, MT:3197T > C, MT:16288T > C, and MT:16359T > C [PMC7920096]. The m.15992A>T mutation in the MT-TP gene was found in all patients [PMC7371370]. In a study comparing gene trees and sequence data analysis, MT-TP (tRNA-Pro) was found to cluster Pteronura brasiliensis with non-otters [PMC3307490]. In Caco-2 cells infected with Salmonella, RNA coding components of the mitochondrial respiratory chain including MT-TP were highly elevated compared to uninfected cells [PMC10076011]. Among 22 mt-tRNAs, eight (MT-TE, MT-TA, MT-TN, MT-TC, MT-TY, MT-TS1, MT-TQ and MT-TP) occur at the L-strand while the rest are present in the H-strand [PMC9657367].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGAGAAUAGUUUAAAUUAGAAUCUUAGCUUUGGGUGCUAAUGGUGGAGUUAAAGACUUUUUCUCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Homo heidelbergensis tRNA-Pro
  2. Homo sapiens neanderthalensis neanderthalensis tRNA-Pro
  3. Homo sapiens subsp. 'Denisova' transfer RNA-Pro
2D structure Publications