Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-1296-5p URS000002103A_9986

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Oryctolagus cuniculus. Annotated by 3 databases (RefSeq, miRBase, MirGeneDB). Oryctolagus cuniculus (rabbit) ocu-miR-1296-5p sequence is a product of miR-1296, ocu-miR-1296-5p, ocu-miR-1296, MIR1296, miR-1296-5p genes. Found in the rabbit reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUAGGGCCCUGGCUCCAUCUCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Bos taurus (cattle) bta-miR-1296
    2. Callithrix jacchus cja-miR-1296
    3. Canis lupus familiaris Cfa-Mir-1296_5p (mature (guide))
    4. Capra hircus chi-miR-1296
    5. Cavia porcellus cpo-miR-1296-5p
    6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-1296-5p
    7. Echinops telfairi Ete-Mir-1296_5p (mature (guide))
    8. Equus caballus (horse) eca-miR-1296
    9. Gorilla gorilla ggo-miR-1296
    10. Homo sapiens hsa-miR-1296-5p
    11. Nomascus leucogenys nle-miR-1296
    12. Otolemur garnettii (small-eared galago) oga-miR-1296
    13. Pan troglodytes ptr-miR-1296
    14. Pongo pygmaeus (Bornean orangutan) ppy-miR-1296
    15. Sus scrofa (pig) ssc-miR-1296-5p
    Publications New