Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cavia porcellus (domestic guinea pig) cpo-miR-1296-5p URS000002103A_10141

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAGGGCCCUGGCUCCAUCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus (cattle) bta-miR-1296
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-1296
  3. Canis lupus familiaris Cfa-Mir-1296_5p (mature (guide))
  4. Capra hircus chi-miR-1296
  5. Dasypus novemcinctus dno-miR-1296-5p
  6. Echinops telfairi Ete-Mir-1296_5p (mature (guide))
  7. Equus caballus eca-miR-1296
  8. Gorilla gorilla gorilla ggo-miR-1296 (MIR1296)
  9. Gorilla gorilla ggo-miR-1296
  10. Homo sapiens hsa-miR-1296-5p
  11. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-1296
  12. Oryctolagus cuniculus (rabbit) ocu-miR-1296-5p
  13. Otolemur garnettii (small-eared galago) oga-miR-1296
  14. Pan troglodytes (chimpanzee) ptr-miR-1296
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-1296
  16. Sus scrofa (pig) ssc-miR-1296-5p