Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-1296-5p URS000002103A_9823

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAGGGCCCUGGCUCCAUCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Bos taurus bta-miR-1296
  2. Callithrix jacchus cja-miR-1296
  3. Canis lupus familiaris Cfa-Mir-1296_5p (mature (guide))
  4. Capra hircus chi-miR-1296
  5. Cavia porcellus (domestic guinea pig) cpo-miR-1296-5p
  6. Dasypus novemcinctus dno-miR-1296-5p
  7. Echinops telfairi Ete-Mir-1296_5p (mature (guide))
  8. Equus caballus (horse) eca-miR-1296
  9. Gorilla gorilla gorilla ggo-miR-1296 (MIR1296)
  10. Gorilla gorilla (western gorilla) ggo-miR-1296
  11. Homo sapiens hsa-miR-1296-5p
  12. Nomascus leucogenys nle-miR-1296
  13. Oryctolagus cuniculus ocu-miR-1296-5p
  14. Otolemur garnettii oga-miR-1296
  15. Pan troglodytes ptr-miR-1296
  16. Pongo pygmaeus ppy-miR-1296
Publications