Dasypus novemcinctus (nine-banded armadillo) dno-miR-1296-5p URS000002103A_9361

• 22 nucleotides
• 2 databases (miRBase, MirGeneDB)
• Found in 16 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UUAGGGCCCUGGCUCCAUCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

1. Bos taurus (cattle) bta-miR-1296
2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-1296
3. Canis lupus familiaris Cfa-Mir-1296_5p (mature (guide))
4. Capra hircus chi-miR-1296
5. Cavia porcellus cpo-miR-1296-5p
6. Echinops telfairi Ete-Mir-1296_5p (mature (guide))
7. Equus caballus eca-miR-1296
8. Gorilla gorilla gorilla ggo-miR-1296 (MIR1296)
9. Gorilla gorilla ggo-miR-1296
10. Homo sapiens hsa-miR-1296-5p
11. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-1296
12. Oryctolagus cuniculus (rabbit) ocu-miR-1296-5p
13. Otolemur garnettii (small-eared galago) oga-miR-1296
14. Pan troglodytes (chimpanzee) ptr-miR-1296
15. Pongo pygmaeus (Bornean orangutan) ppy-miR-1296
16. Sus scrofa (pig) ssc-miR-1296-5p

Download

• FASTA
• JSON